*NCBI Gene # or RefSeq#: 958674 *Protein ID (NP or XP #) or Wolbachia#: MTCY182.45, MTCY398.12 *Organism (including strain):Mycobacterium tuberculosis
Etiologic Risk Group (see link below): Risk Group 2 (WHO)
*Background/Disease Information (sort of like the Intro to your Mini Research Write up): The Mycobacterium tuberculosis causes a virulent disease that has infected a large portion of the world's population. It is spread through aerosols, so actions such as coughing or sneezing from an infected individual may release the pathogen into the air. The symptoms of this disease include chronic coughing, chest pain, fever, and chills. This is why individuals who are immunodeficient are highly susceptible to tuberculosis. Though the pathogen normally targets the lungs, other parts of the body are susceptible too.
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents): Assay information No assay information for this target. Reagent availability
No reagent availability information for this target. -- link to Sigma (or other company) page for assay (see Sigma links below)-http://www.sigmaaldrich.com/catalog/product/fluka/36131?lang=en®ion=US --- List cost and quantity of substrate reagents, supplier, and catalog # Ioxynil PESTANAL- 36131-100MG- $45.50- Sigma-Aldrich
Structure Available (PDB or Homology model) -- PDB # or closest PDB entry if using homology model: 1Y6X
Current Inhibitors: none Expression Information (has it been expressed in bacterial cells): no Purification Method: 6x HIS Ni-NTA Column Chromatography Image of protein (PyMol with features delineated and shown separately):
image.jpg
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):
*Length of your protein in Amino Acids: 93
*Molecular Weight of your protein in kiloDaltons using the Expasy ProtParam website:
10274.6 kiloDaltons
Capture2.JPG
*Graph Image Input your amino acid sequence to it.
ATGACCGACGCTGAGACATCACCGCAGGGGCCGCTGGACCCCACGACTCTGGATTTCGCCAAGATGGACG
GCCTGCTGCCCTGCATCGTGCAAGACGCCGACACCGCGCAGGTGCTGATGCTGGGCTATATGAACGAAGA
AGCGCTTGAGCGCACGCAGGAGCGTGGCCTGGTCACCTTTTACAGCCGGTCCAAGGGGCGCCTGTGGACC
AAAGGTGAAAGTTCCGGCCACACCTTGCAGCTGGTCCGCCTAAGCACCGACTGCGACAGCGACGCACTGT
TGGTCCTGACCCGCCCACAGGGACCGACCTGCCACACCGGGGCCGTCAGCTGCTTTAGCGTGCAGCCGCC
TGCACTGGAAATGCTGGGCCGCCTGGAACGCACTGTGCAGGGCCGCCGGGACGCCGACCCGCAGGCGAGC
TACACCGCCCGGCTCCTGCAGGGCGAACCGCGCCGCGCGGCCCAGAAGGTAGGCGAGGAAGGAGTGGAAG
TGGCCCTGGCCGCTCTGGCGCAAAGTGACGAGGAGTTGGCGGGTGAGGCCGCCGACCTGCTCTATCACCT
GCTGGTGGTGCTGGCCCTGCGCGGCCTGCGGTTGGCAGATGTGCTGGCCGTGCTGCACGGGCGTTCCCAC
TGA
Do Not Need this info(but still copy these lines to your Target page for now)</span>
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers)
link to DNA Works output that should be saved in your folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences)
*Target (protein/gene name): Rv2122c, Mycobacterium tuberculosis, Probable phosphoribosyl-AMP pyrophosphatase HisE
*NCBI Gene # or RefSeq#: 958674*Protein ID (NP or XP #) or Wolbachia#: MTCY182.45, MTCY398.12
*Organism (including strain): Mycobacterium tuberculosis
Etiologic Risk Group (see link below): Risk Group 2 (WHO)
*Background/Disease Information (sort of like the Intro to your Mini Research Write up):
The Mycobacterium tuberculosis causes a virulent disease that has infected a large portion of the world's population. It is spread through aerosols, so actions such as coughing or sneezing from an infected individual may release the pathogen into the air. The symptoms of this disease include chronic coughing, chest pain, fever, and chills. This is why individuals who are immunodeficient are highly susceptible to tuberculosis. Though the pathogen normally targets the lungs, other parts of the body are susceptible too.
Link to TDR Targets page (if present): http://tdrtargets.org/targets/view?gene_id=6216
Link to Gene Database page (NCBI, EuPath databases -e.g. TryTryp, PlasmoDB, etc - or PATRIC, etc.):
http://www.ncbi.nlm.nih.gov/protein/CAD96999.1
Essentiality of this protein:
Rv2122c has essentiality data
Gene/Ortholog: mtu2155 (OG4_20466); Phenotype: essential; Source study: nmpdr
Complex of proteins?: No
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
No chemical compounds associated to this gene
*EC#: 3.6.1.31
Link to BRENDA EC# page:
http://www.brenda-enzymes.org/php/result_flat.php4?ecno=3.6.1.31&Suchword=&organism%5B%5D=Mycobacterium+tuberculosis&show_tm=0
Enzyme Assay information (spectrophotometric, coupled assay ?, reagents):
Assay information
No assay information for this target.
Reagent availability
No reagent availability information for this target.
-- link to Sigma (or other company) page for assay (see Sigma links below)- http://www.sigmaaldrich.com/catalog/product/fluka/36131?lang=en®ion=US
--- List cost and quantity of substrate reagents, supplier, and catalog # Ioxynil PESTANAL- 36131-100MG- $45.50- Sigma-Aldrich
Structure Available (PDB or Homology model)
-- PDB # or closest PDB entry if using homology model: 1Y6X
Current Inhibitors: none
Expression Information (has it been expressed in bacterial cells): no
Purification Method: 6x HIS Ni-NTA Column Chromatography
Image of protein (PyMol with features delineated and shown separately):
*Amino Acid Sequence (paste as text only - not as screenshot or as 'code'):